skip to content »

Molecular and Cellular Biology - Rosen Lab

Houston, Texas

BCM faculty, staff and trainees are the heart of the organization.
Rosen Lab
not shown on screen

WKbpAII Vector

*** The vector sequence has now been corrected as of July 13, 2004. The WAP/KCR/bGHpA cassette was inverted in the pBluescript vector ***

WKbpA: WAP5' cloned into KbpA vector (originally cloned by S. Chua, Baylor College of Medicine)

WAP5' = -944 to +33 rat Whey Acidic Protein (WAP) promoter

KbpA vector:
KCR = 640 bp portion of rabbit B-globin gene containing 18 bp of exon II, 572 bp of intron 2, and 50 bp of exon II

Notes:

  • Having an intron 5' of your gene greatly increases mammary gland-specific expression, even of large cDNAs (we found expression of 3.3 kb cDNA).
  • The 5' intron works much better than a 3' intron, probably by disguising the cDNA as a terminal exon instead of an internal exon (large terminal exons occur in nature, while internal exons are almost always quite small).

bpA = bovine Growth Hormone poly A signal

The WKbpA construct was subcloned into pBluescript II, which contains BssHII sites flanking the MCS. These are used to cut out the whole transgene for microinjection into embryos. This final construct is called WKbpAII.


Clone your gene of interest into the EcoRI site at 3870, downstream of the KCR element.

MKbpAII


WKbpAII sequence:
Vector sequence in italics
WAP in red
KCR intron in blue
EcoRI cloning site underlined
bGHpA in green

BssHII sites flanking cassette in pink

gtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatatt
gaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagat
gctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttt
taaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtca
cagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggagga
ccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacac
cacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagt
tgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatg
gtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggta
actgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaac
gtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc
taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgta
gttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttg
gactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagat
acctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggg
agcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaa
acgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtg
agctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttg
gccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggcttt
acactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcact
aaagggaacaaaagctggagctccaccgcggtggcggcctcgacggccacagtgaagacctccggccaGTCAAAGGAGTATGGGCTGCACCAT
AGGCTGGCGCTGACAGCCAGTAAACACACAGTCACTCACTCTGAGTCATTGCATCCCCTTCCTTGCAAGAGAAGTCA
AGGAAATGTCCCGAGAGCAATGGGCACAGTGCCCAACAGGACATCCCATCCGGGCCCATGACACCGTTGGCACAG
CATGGGGCCCTTCTGAGAAGTGGGCTTCCAAGGTTCCCTGCACAGGCAATCCTTTTTTGATGTGTACCCTGTACTCT
CTACAAGGAGCAAGTGCCTCCACATTCTTATAAAACTTTTTAGAAAACTCCAGAAAAGCACCAGGAAAAGAAACCAT
CCTCTGATGTGACTGTACACATTTGGAGCTCGGAATTTCCTTTTTTTTTTTTTTTTAAAGATTTTTATTTATTTCATGTA
TGTGAGCACACTGTCGCTATCTTCAGACACACCAGAAGAGGGCATCAGATCCCACTGGATCCCAGATGGTTGTGAG
CCACCATGTGGTTGCTGGGACCTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCCCAACCACTGAGCCATCTCT
CCAGCCCTCGGAATTTCCTTTGTCTGAGAAAGGGGTCCCAACCCAACCATTCAAAGTGATATCTGTCACATTTGTTAC
AGATCCCATTTCTTCCTTCTCTGCTCCTTAATTTTCTTCATTTTCACGATAAACAAGTTTTACCTTTTAAGTGGAAAAAT
AACGACCACCCTTACAAAGGACTTCTTAAAAATGGACTCCATTGTGAGCCTTGTTCCTGGCAGCCTGGGCCTGCTCT
CTGCATGTGTCCAAGAAGGAAGTGTTTTAGCCCATCTACGCCTATGCAAGCCTGCCCCCCTCCTTCCCCAAAGTCTT
CCTCCTGTGGGTCCTTTAAATGCATCCCAGACACTCAGGCTACCATCAGTCATCACTTGCCTGCCGCCGCCGACACC
ggatccactagttctagaactagtggatccTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGT
AAAATTCATGTTATATGGAGGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATG
GACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTG
TAACTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGAATTTTTAAATTCACTTTTGTTTATTTGTCAGATTGTAAGTAC
TTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGGTATATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTAT
AATTAAATGATAAGGTAGAATATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTAC
ATCCTGGTCATCATCCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGT
CCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGT
GCTGTCTCATCATTTTGGCAAAgaattcgatctagagctcGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTT
GTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTG
CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAA
GACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGctcgagatccac
tagttctagcctcgaatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttac
aacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcc
caacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccc
tagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacct
cgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttcc
aaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattt
taacaaaatattaacgcttacaatttag


E-mail this page to a friend