skip to content »

Molecular and Cellular Biology - Rosen Lab

Houston, Texas

BCM faculty, staff and trainees are the heart of the organization.
Rosen Lab
not shown on screen

MKbpAII Vector

MKbpA: MMTV-LTR cloned into KbpA vector (originally cloned by S. Chua, Baylor College of Medicine)
MMTV-LTR: 2.334 kb fragment cloned into BamHI site of KbpA vector

KbpA vector:
KCR = 640 bp portion of rabbit beta-globin gene containing 18 bp of exon II, 572 bp of intron 2, and 50 bp of exon II

Notes:

  • Having an intron 5' of your gene greatly increases mammary gland-specific expression, even of large cDNAs (we found expression of 3.3 kb cDNA).
  • The 5' intron works much better than a 3' intron, probably by disguising the cDNA as a terminal exon instead of an internal exon (large terminal exons occur in nature, while internal exons are almost always quite small).

bpA = bovine Growth Hormone poly A signal

The MKbpA construct was subcloned into pBluescript II, which contains BssHII sites flanking the MCS. These are used to cut out the whole transgene for microinjection into embryos. This final construct is called MKbpAII.


Clone your gene of interest into the EcoRI site at 3667, downstream of the KCR element.

MKbpAII


MKbpAII sequence:

  • Vector sequence in italics
  • MMTV in red
  • KCR intron in blue
  • EcoRI cloning site underlined
  • bGHpA in green

CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGC
TCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGA
CCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAAC
GTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC
GTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAAT
CGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAAC
GTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGC
AAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCC
GCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCG
ATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGC
AAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACG
ACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCAC
CGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCAATGATAGAGATTTCACTGC
ACTAGTCCCCCATACAGAATTGTTTCGCTTAGTCGCAGCCTCAAGACATCTTATT
CTCAAAAGGCCAGGATTTCAAGAACATGAGATGATTCCTACATCTGCCTGTGTT
ACTTACCCTTATGCCATATTATTAGGATTACCTCAGTTAATAGATATAGAGAAAA
GAGGATCTACTTTTCATATTTCCTGTTCTTCTTGTAGATTGACTAATTGTTTAGAC
TCTTCTGCCTACGACTATGCAGCGATCATAGTCAAGAGGCCGCCATATGTGCTG
CTACCTGTAGATATTGGTGATGAACCATGGTTTGATGATTCTGCCATTCAAACCT
TTAGGTATGCCACAGATTTAATTCGAGCTAAGCGATTCGTCGCAGCCATTATCC
TGGGCATATCTGCTTTGATTGCTATTATTACTTCCTTTGCTGTAGCTACTACTGC
CTTAGTTAAGGAGATGCAAACTGCTACGTTTGTTAATAATCTTCATAGGAATGTT
ACATTAGCCTTATCTGAACAACGGATAATAGATTTAAAATTAGAAGCTAGACTTA
ATGCTTTAGAAGAAGTAGTTTTAGAGTTGGGACAAGATGTGGCCAATTTAAAGA
CCAGAATGTCCACTAGGTGTCATGCAAATTATGACTTTATCTGCGTTACACCTTT
ACCCTATAATGCTACTGAGAACTGGGAAAGAACCAGGGCTCATTTATTGGGCAT
TTGGAATGATAATGAGATTTCATATAACATACAGGAGTTAACCAACCTGATTAG
TGATATGAGCAAACAACATATTGATGCAGTGGACCTTAGTGGCTTGGCTCAGTC
TTTTGCCAATGGAGTGAAGGCTTTAAATCCATTAGATTGGACACAATATTTCATT
TTTATAGGTGTTGGAGCCCTGCTTTTAGTCATTGTACTTATGATTTTCCCCATTG
TTTTCCAGTGCCTTGCGAAGAGCCTTGACCAAGTGCAGTCAGATCTTAACGTGC
TTCTTTTAAAAAAGAAAAAAGGGGGAAATGCCGCGCCTGCAGCAGAAATGGTT
GAACTCCCGAGAGTGTCCTACACTTAGGGGAGAAGCAGCCAAGGGGTTGTTTC
CCACCAAGGACGACCCGTCTGCGCACAAACGGATGAGCCCATCAGACAAAGAC
ATACTCATTCTCTGCTGCAAACTTGGCATAGCTCTGCTTTGCCTGGGGCTATTG
GGGGAAGTTGCGGTTCGTGCTCGCAGGGCTCTCACCCTTGACTCTTTTAATAGC
TCTTCTGTGCAAGATTACAATCTAAACGATTCGGAGAACTCGACCTTCCTCCTG
AGGCAAGGACCACAGCCAACTTCCTCTTACAAGCCGCATCAACCTTGTCCTTCA
GAAATAGAAATAAGAATGCTTGCTAAAAATTATATTTTTACCAATAAGACCAATC
CAATAGGTAGATTATTAGTTACTATGTTAAGAAATGAATCATTACCTTTTAGTAC
TATTTTTACTCAAATTCAAAGGTTAGAAATGGGAATAGAAAATAGAAAGAGACA
CTCAACCTCAGTTGAAGAACAGGTGCAGGGACTAAGGGCCTCAGGCCTAGAAG
TAAAAAGGGGAAAGAGGAGTGCGCTTGTCAAAATAGGAGACAGGTGGTGGCA
ACCAGGGACTTATAGGGGACCTTACATCTACAGACCAACAGATGCCCCCTTACC
GTATACAGGAAGATATGACCTAAATTTTGATAGGTGGGTCACAGTCAATGGCTA
TAAAGTGTTATACAGGTCCCTCTCCTTTCGTGAAAGGCTCGCCAGGGCTAGACC
TCCTTGGTGTATGTTGACTCAGGAAGAGAAAAACGACATGAAACAACAGGTAC
ATGATTATATTTATTTGGGAACAGGAATGAGCAGCATTTGGGGAAAGATTTTTC
ATACCAAGGAGAGGACAGTGGCTGCACTAATAGAGCACTATTCTGCAAAGACT
TATGGCATGAGTTATTATGATTAGCCTTTATTAGCCCAATCTTGTGGTTCCCAAG
GTTTAAGTAAGTTCATGGTCACAGACTGTTCTTAAAACAAGGATGTGAGACAAG
TGGTTTCC
TGACTTGGCTTGGTATCAAATGTTTTGATCTAAGCTCTAAATGCTCT
AACCTCCTATGTTCTTTTGGATTCTATCCAAGTTTTATGTAAATGCTTATGTAAAC
CATGATATAAAAGAGTGCTAAATTTTTGAGTAAACTTGCAACAGTCCTAACATTC
ACCTCTCGTGTGTTTGTGTCTGTTCGCCATCCCGTCTCCGCTCGTCACTTATCCT
TCACTTTCCAGAGGGTCCCCCCGCAGACCCCGGATCCTGAGAACTTCAGGGTGAGT
TTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGTAAAATTCATGTTATATGGAGGGG
GCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTC
ATGATAATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTATTTTC
TTTTCATTTTCTGTAACTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGAATTTTTAAAT
TCACTTTTGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTTTCAAGGCAA
TCAGGGTATATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGA
TAAGGTAGAATATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAA
ACAACTACATCCTGGTCATCATCCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTT
TGAGATGAGGATAAAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCC
TTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTG
GCAAA
GAATTCGATCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGT
TGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGG
AAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATC
GCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAG
GACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGG
CTCGAG
ATCCACTAGTTCTAGCCTCGAATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCG
GTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCAT

AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAG
CATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGC
TCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAAC
GCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCT
GCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTA
TCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCA
GGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCA
TCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG
GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGAT
ACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTA
TCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAG
CCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT
TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGC
TACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATC
TGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAAC
AAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAA
AGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAAC
TCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAA
ATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTA
CCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTT
GCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG
CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCC
AGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTG
CCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGG
TTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCC
TTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGG
CAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGA
GTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCG
TCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAAC
GTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACC
CACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA
AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATAC
TCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGG
ATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGA
AAAGTGCCAC

E-mail this page to a friend