skip to content »

Path-Immuno - Tom Cooper Lab

Houston, Texas

BCM faculty, staff and trainees are the heart of the organization.
Path-Immuno - Tom Cooper Lab
not shown on screen

Reagents

tgcugbp (CUG-BP) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

tgetr3 (ETR-3) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

3.1CBP3R (CELF3) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

NCELF4h (CELF4) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

tgCELF5.4 (CELF5) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

3.1CELF6orf1 (CELF6) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

PTBΔ294W (PTB dominant negative) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

DBPB (YB-1) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase

back to top

Minigenes (splicing reporters, amp resistant)

Exons are in upper case

RTB33.51 (chicken cTNT) Exons and plasmid in upper case

RT and reverse primer: TNIE4 (5' AGGTGCTGCCGCCGGGCGGTGGCTG 3')
Forward primer: RSV5U (5' CATTCACCACATTGGTGTGC 3')

back to top

RTB300 (human cTNT)
Same RT and PCR oligos as RTB33.51 above

back to top

R300TA (human cTNT, CELF nonresponsive)
Same RT and PCR oligos as RTB33.51 above

back to top

RTBPSRAX (ß-globin substitution)
Same RT and PCR oligos as RTB33.51 above

back to top

4.11.12muC (test exon sequences, ß-globin context) Amp resistance

RT and reverse primer: HBG3 (5' AGAACCTCTGGGTCCAAGGGTAG 3')
Forward primer: RSV5U (5' CATTCACCACATTGGTGTGC 3')

back to top

RG6 (fluorescent protein splicing reporter) See Nuc. Acids Res. 34, e148. Note that the XbaI site is methyl sensitive and will cut only if the plasmid is prepared from Dam-minus bacteria.

back to top

FRE5 (lab name is FLAGNLSREDGFP5; see Nuc. Acids Res. 34, e148).

back to top

RHCglo [our favorite splicing minigene reporter; see BioTechniques 41, 177 (2006)] (MTA required)

RT and reverse primer: RTRHC (5' GGGCTTTGCAGCAACAGTAAC 3') or TNIE4 (5’ AGGTGCTGCCGCCGGGCGGTGGCTG 3’)
Forward primer: RSV5U (5' CATTCACCACATTGGTGTGC 3')

back to top

CTG repeat expression plasmids

DT960 (DMPK minigene with 950 repeats in exon 15) Amp resistance

back to top

DMPKS (DMPK minigene with no repeats, kanamycin resistance)

back to top

In vitro splicing templates (amp resistant)

E46NB (chicken cTNT in vitro splicing template) KS+, amp resistance

back to top

E-mail this page to a friend