tgcugbp (CUG-BP) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
tgetr3 (ETR-3) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
3.1CBP3R (CELF3) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
NCELF4h (CELF4) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
tgCELF5.4 (CELF5) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
3.1CELF6orf1 (CELF6) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
PTBΔ294W (PTB dominant negative) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
DBPB (YB-1) pcDNA3.1 HisC, Xpress tagged, amp resistant, Open reading frame is in lowercase
Exons are in upper case
RTB33.51 (chicken cTNT) Exons and plasmid in upper case
RT and reverse primer: TNIE4 (5' AGGTGCTGCCGCCGGGCGGTGGCTG 3')
Forward primer: RSV5U (5' CATTCACCACATTGGTGTGC 3')
RTB300 (human cTNT)
Same RT and PCR oligos as RTB33.51 above
R300TA (human cTNT, CELF nonresponsive)
Same RT and PCR oligos as RTB33.51 above
RTBPSRAX (ß-globin substitution)
Same RT and PCR oligos as RTB33.51 above
4.11.12muC (test exon sequences, ß-globin context) Amp resistance
RT and reverse primer: HBG3 (5' AGAACCTCTGGGTCCAAGGGTAG 3')
Forward primer: RSV5U (5' CATTCACCACATTGGTGTGC 3')
RG6 (fluorescent protein splicing reporter) See Nuc. Acids Res. 34, e148. Note that the XbaI site is methyl sensitive and will cut only if the plasmid is prepared from Dam-minus bacteria.
FRE5 (lab name is FLAGNLSREDGFP5; see Nuc. Acids Res. 34, e148).
RHCglo [our favorite splicing minigene reporter; see BioTechniques 41, 177 (2006)] (MTA required)
RT and reverse primer: RTRHC (5' GGGCTTTGCAGCAACAGTAAC 3') or TNIE4 (5’ AGGTGCTGCCGCCGGGCGGTGGCTG 3’)
Forward primer: RSV5U (5' CATTCACCACATTGGTGTGC 3')
DT960 (DMPK minigene with 950 repeats in exon 15) Amp resistance
DMPKS (DMPK minigene with no repeats, kanamycin resistance)